Review



prn3p gfp burton  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc prn3p gfp burton
    Prn3p Gfp Burton, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prn3p+gfp+burton/pRN3P_membrane_EGFP+(Plasmid+%23139402)/pm40273908-333-11-9
    Average 93 stars, based on 6 article reviews
    prn3p gfp burton - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    BAC Assay:

    Article Title: The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER End-It DNA end-repair kit Epicentre Cat#ER81050 QIAquick PCR purification kit Qiagen Cat#28104 AMPure RNA magnetic beads Beckman Coulter Cat#A63987 AMPure XP DNA magnetic beads Beckman Coulter Cat#A63881 Nextera XT Illumina Cat#15032354 NucleoBond BAC 100 kit Macherey-Nagel Cat#740579 Nick translation mix Roche Cat#10976776001 Deposited data Single-cell RNA-seq data of mouse oocytes and preimplantation embryos Ramsköld et al.49; Deng et al.50 GEO: GSE38495, GSE45719 ATAC-seq Wu et al.51 GEO: GSE66581 H3K4me3 ChIP data Zhang et al.52 GEO: GSE71434 H3K36me3 ChIP data Xu et al.53 GEO: GSE112834 H3K27ac ChIP data Dahl et al.54 GEO: GSE72784 H3K9me3 ChIP data Wang et al.33 GEO: GSE98149 H3K27me3 ChIP data Zheng et al.37 GEO: GSE76687 Pol2 Stacc-seq data Liu et al.55 GEO: GSE135457 DNaseI-seq data Lu et al.56 GEO: GSE76642 Hi-C data Du et al.57 GEO: GSE82185 Single-embryo RNA-seq (SMART-seq+50) Oomen et al.58 GEO: GSE225056 Embryo LaminB1 DamID data and Allelic LAD coordinates Borsos et al.24 GEO: GSE112551 a-amanitin treatment LaminB1 DamID data Pal et al.25 GEO: GSE241483 LaminB1 DamID This paper GEO: GSE244496 H3K9me3 CUT&RUN This paper GEO: GSE278718 H3K4me3 CUT&Tag This paper GEO: GSE278719 Single-embryo RNA-seq (SMART-seq+50) This paper GEO: GSE278720 Experimental models: Organisms/strains Mouse: F1 (C57BL/6J 3 CBA/H) females Janvier Labs MGI:5650652 Mouse: DBA/2J males Janvier Labs MGI:2684695 Oligonucleotides DamID Adapter_top: 5’-CTAATACGACT CACTATAGGGCAGCGTGGTCG CGGCCGAGGA-3’ Sigma Aldrich N/A DamID Adapter_bottom: 5’-TCCTCGGCCGCG-3’ Sigma Aldrich N/A Barcoded DamID PCR primers: 5’-NNNNNNBAR CODGTGGTCGCGGCCGAGGATC-3’ Sigma Aldrich N/A ERCC RNA spike in mix Invitrogen Cat#4456740 oligo-dT30V: 5’-AAGCAGTGGTATCA ACGCAGAGTACT30V-3’ Sigma Aldrich N/A TSO:5’-AAGCAGTGGTATCAACG CAGAGTACATrGrG+G-3’ TIB MolBiol N/A ISPCR oligo: 50-AAGCAGTGGTA TCAACGCAGAGT-30 Biomers.net N/A Illumina sequencing adaptor mix and primers IDT or Sigma Aldrich N/A Recombinant DNA pRN3P-AID-Dam-LaminB1 Borsos et al.24 N/A pRN3P-TIR1-3XMyc Borsos et al.24 Addgene #119766 pRN3P-EGFP-m6ATracer Borsos et al.24 Addgene #139403 (Continued on next page) ll OPEN ACCESS Cell 188, 1–20.e1–e9, June 26, 2025 e3 Please cite this article in press as: Pal et al., The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways, Cell (2025), https://doi.org/10.1016/j.cell.2025.03.044 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pRN3P-membrane-EGFP Borsos et al.24 Addgene #139402 pRN3P-GFP Burton et al.34 N/A pRN3P-HA-DN-Baf-G25E Haraguchi et al.59 N/A pRN3P-HA-DN-Prr14 Yang et al.60 N/A pRN3P-HA-mCherry-DN Syne1 Lombardi et al.61 N/A pRN3P-HA-Exportin6 Baarlink et al.30 N/A pRN3P-EzrinTD-mCherry-VCA Chaigne et al.29 N/A pcDNA3-Flag-Tpr Vomastek et al.62 Addgene #60882 pRN3P-HA-del-Nup98 Liang et al.31 N/A pRN3P-HA-DN-NM1 Ye et al.63 N/A pGEMHE-mCherry-MyoVbTail Provance et al.64 N/A pRN3P-HA-NLS-Actin-R62D Posern et al.65 N/A pRN3P-Hdac3-Flag This paper N/A pRN3P-HA-Kdm6a This paper N/A pcDNA-Flag-Kdm6b(1025-End)-pA Inoue et al.35 Addgene #100278 pRN3P-HA-Set8 This paper N/A pRN3P-HA-Suv420h1 Eid et al.66 Addgene #86689 pRN3P-HA-Suv420h2 Eid et al.66 Addgene #86691 pRN3P-HA-Kdm3a This paper N/A pRN3P-HA-Kdm3b This paper N/A pRN3P-HA-Lsd1 This paper N/A pRN3P-HA-Kdm7a This paper N/A pRN3P-HA-Kdm7c This paper N/A pRN3P-HA-Suv39h1 Burton et al.34 N/A pRN3P-HA-Hp1a This paper N/A pRN3P-HA-Hp1g This paper N/A pRN3P-HA-Phf19 This paper N/A pRN3P-HA-G2e3 This paper N/A pRN3P-HA-Dhx33 This paper N/A pRN3P-Hdac1-HA This paper N/A pRN3P-Hdac6-HA This paper N/A pcDNA3-Flag-Sirt1 Deota et al.67 Addgene #105670 pRN3P-HA-H1.2 This paper N/A pRN3P-HA-H1.4 This paper N/A pRN3P-HA-H1.5 This paper N/A pRN3P-HA-macroH2A.1.1 This paper N/A pRN3P-HA-Ehmt1 This paper N/A pRN3P-HA-Ehmt2 Burton et al.34 N/A pRN3P-HA-Setdb1 Burton et al.34 N/A pRN3P-HA-Sedb2 Burton et al.34 N/A BAC DNAs, see Table S1 BACPAC N/A Software and algorithms Snakemake Mölder et al.68 https://snakemake.github.io R R Core Team https://www.r-project.org Trimmomatic Bolger et al.69 http://www.usadellab.org/cms/?page=trimmomatic STAR Dobin et al.70 https://github.com/alexdobin/STAR TEtranscripts (TEcount) Jin et al.71 https://hammelllab.labsites.cshl.edu/software/ DEseq2 Love et al.72 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html (Continued on next page) ll OPEN ACCESS e4 Cell 188, 1–20.e1–e9, June 26, 2025 Please cite this article in press as: Pal et al., The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways, Cell (2025), https://doi.org/10.1016/j.cell.2025.03.044 Resource ..

    Software:

    Article Title: The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER End-It DNA end-repair kit Epicentre Cat#ER81050 QIAquick PCR purification kit Qiagen Cat#28104 AMPure RNA magnetic beads Beckman Coulter Cat#A63987 AMPure XP DNA magnetic beads Beckman Coulter Cat#A63881 Nextera XT Illumina Cat#15032354 NucleoBond BAC 100 kit Macherey-Nagel Cat#740579 Nick translation mix Roche Cat#10976776001 Deposited data Single-cell RNA-seq data of mouse oocytes and preimplantation embryos Ramsköld et al.49; Deng et al.50 GEO: GSE38495, GSE45719 ATAC-seq Wu et al.51 GEO: GSE66581 H3K4me3 ChIP data Zhang et al.52 GEO: GSE71434 H3K36me3 ChIP data Xu et al.53 GEO: GSE112834 H3K27ac ChIP data Dahl et al.54 GEO: GSE72784 H3K9me3 ChIP data Wang et al.33 GEO: GSE98149 H3K27me3 ChIP data Zheng et al.37 GEO: GSE76687 Pol2 Stacc-seq data Liu et al.55 GEO: GSE135457 DNaseI-seq data Lu et al.56 GEO: GSE76642 Hi-C data Du et al.57 GEO: GSE82185 Single-embryo RNA-seq (SMART-seq+50) Oomen et al.58 GEO: GSE225056 Embryo LaminB1 DamID data and Allelic LAD coordinates Borsos et al.24 GEO: GSE112551 a-amanitin treatment LaminB1 DamID data Pal et al.25 GEO: GSE241483 LaminB1 DamID This paper GEO: GSE244496 H3K9me3 CUT&RUN This paper GEO: GSE278718 H3K4me3 CUT&Tag This paper GEO: GSE278719 Single-embryo RNA-seq (SMART-seq+50) This paper GEO: GSE278720 Experimental models: Organisms/strains Mouse: F1 (C57BL/6J 3 CBA/H) females Janvier Labs MGI:5650652 Mouse: DBA/2J males Janvier Labs MGI:2684695 Oligonucleotides DamID Adapter_top: 5’-CTAATACGACT CACTATAGGGCAGCGTGGTCG CGGCCGAGGA-3’ Sigma Aldrich N/A DamID Adapter_bottom: 5’-TCCTCGGCCGCG-3’ Sigma Aldrich N/A Barcoded DamID PCR primers: 5’-NNNNNNBAR CODGTGGTCGCGGCCGAGGATC-3’ Sigma Aldrich N/A ERCC RNA spike in mix Invitrogen Cat#4456740 oligo-dT30V: 5’-AAGCAGTGGTATCA ACGCAGAGTACT30V-3’ Sigma Aldrich N/A TSO:5’-AAGCAGTGGTATCAACG CAGAGTACATrGrG+G-3’ TIB MolBiol N/A ISPCR oligo: 50-AAGCAGTGGTA TCAACGCAGAGT-30 Biomers.net N/A Illumina sequencing adaptor mix and primers IDT or Sigma Aldrich N/A Recombinant DNA pRN3P-AID-Dam-LaminB1 Borsos et al.24 N/A pRN3P-TIR1-3XMyc Borsos et al.24 Addgene #119766 pRN3P-EGFP-m6ATracer Borsos et al.24 Addgene #139403 (Continued on next page) ll OPEN ACCESS Cell 188, 1–20.e1–e9, June 26, 2025 e3 Please cite this article in press as: Pal et al., The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways, Cell (2025), https://doi.org/10.1016/j.cell.2025.03.044 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pRN3P-membrane-EGFP Borsos et al.24 Addgene #139402 pRN3P-GFP Burton et al.34 N/A pRN3P-HA-DN-Baf-G25E Haraguchi et al.59 N/A pRN3P-HA-DN-Prr14 Yang et al.60 N/A pRN3P-HA-mCherry-DN Syne1 Lombardi et al.61 N/A pRN3P-HA-Exportin6 Baarlink et al.30 N/A pRN3P-EzrinTD-mCherry-VCA Chaigne et al.29 N/A pcDNA3-Flag-Tpr Vomastek et al.62 Addgene #60882 pRN3P-HA-del-Nup98 Liang et al.31 N/A pRN3P-HA-DN-NM1 Ye et al.63 N/A pGEMHE-mCherry-MyoVbTail Provance et al.64 N/A pRN3P-HA-NLS-Actin-R62D Posern et al.65 N/A pRN3P-Hdac3-Flag This paper N/A pRN3P-HA-Kdm6a This paper N/A pcDNA-Flag-Kdm6b(1025-End)-pA Inoue et al.35 Addgene #100278 pRN3P-HA-Set8 This paper N/A pRN3P-HA-Suv420h1 Eid et al.66 Addgene #86689 pRN3P-HA-Suv420h2 Eid et al.66 Addgene #86691 pRN3P-HA-Kdm3a This paper N/A pRN3P-HA-Kdm3b This paper N/A pRN3P-HA-Lsd1 This paper N/A pRN3P-HA-Kdm7a This paper N/A pRN3P-HA-Kdm7c This paper N/A pRN3P-HA-Suv39h1 Burton et al.34 N/A pRN3P-HA-Hp1a This paper N/A pRN3P-HA-Hp1g This paper N/A pRN3P-HA-Phf19 This paper N/A pRN3P-HA-G2e3 This paper N/A pRN3P-HA-Dhx33 This paper N/A pRN3P-Hdac1-HA This paper N/A pRN3P-Hdac6-HA This paper N/A pcDNA3-Flag-Sirt1 Deota et al.67 Addgene #105670 pRN3P-HA-H1.2 This paper N/A pRN3P-HA-H1.4 This paper N/A pRN3P-HA-H1.5 This paper N/A pRN3P-HA-macroH2A.1.1 This paper N/A pRN3P-HA-Ehmt1 This paper N/A pRN3P-HA-Ehmt2 Burton et al.34 N/A pRN3P-HA-Setdb1 Burton et al.34 N/A pRN3P-HA-Sedb2 Burton et al.34 N/A BAC DNAs, see Table S1 BACPAC N/A Software and algorithms Snakemake Mölder et al.68 https://snakemake.github.io R R Core Team https://www.r-project.org Trimmomatic Bolger et al.69 http://www.usadellab.org/cms/?page=trimmomatic STAR Dobin et al.70 https://github.com/alexdobin/STAR TEtranscripts (TEcount) Jin et al.71 https://hammelllab.labsites.cshl.edu/software/ DEseq2 Love et al.72 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html (Continued on next page) ll OPEN ACCESS e4 Cell 188, 1–20.e1–e9, June 26, 2025 Please cite this article in press as: Pal et al., The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways, Cell (2025), https://doi.org/10.1016/j.cell.2025.03.044 Resource ..



    Similar Products

    93
    Addgene inc prn3p gfp burton
    Prn3p Gfp Burton, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prn3p+gfp+burton/pRN3P_membrane_EGFP+(Plasmid+%23139402)/pm40273908-333-11-9
    Average 93 stars, based on 1 article reviews
    prn3p gfp burton - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results